Even though we are all unique, most of our DNA is actually identical to other people’s DNA. However, specific regions vary highly between people, these regions are called polymorphic. Differences in these variable regions between people are known as polymorphisms. Each of us inherits a unique combination of polymorphisms from our parents. DNA polymorphisms can be analysed to give a DNA profile.

Human DNA profiles can be used to identify the origin of a DNA sample at a crime scene, or test for parentage.

The current technique for DNA profiling uses polymorphisms called short tandem repeats.

What are short tandem repeats?

Short tandem repeats (or STRs) are regions of noncoding DNA that contain repeats of the same nucleotide sequence. For example, GATAGATAGATAGATAGATAGATA is a STR where the nucleotide sequence GATA is repeated six times.

STRs are found at different places or genetic loci in a person’s DNA.

What is a DNA profile?

Chromosomes

To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These genetic loci are usually on different chromosomes.

A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a particular person.

How do you create a DNA profile?

1. Get a sample of DNA

DNA is found in most cells of the body, including white blood cells, semen, hair roots, and body tissue. Traces of DNA can also be detected in body fluids, such as saliva and perspiration because they also contain epithelial cells. Forensic scientists and police officers collect samples of DNA from crime scenes. DNA can also be collected directly from a person using a mouth swab (which collects inner cheek cells).

2. Extract the DNA

DNA is contained within the nucleus of cells. Chemicals are added to break open the cells, extract the DNA, and isolate it from other cell components.

3. Copy the DNA

Often only small amounts of DNA are available for forensic analysis, so the STRs at each genetic locus are copied many times using the polymerase chain reaction (PCR) to get enough DNA to make a profile.

Get information sheet: Polymerase chain reaction (PCR)

Specific primers are used during PCR, which attach a fluorescent tag to the copied STRs.

4. Determine the size of the STRs

The size of the STRs at each genetic locus is determined using a genetic analyser. The genetic analyser separates the copied DNA by gel electrophoresis and can detect the fluorescent dye on each STR. This is the same piece of equipment used in the lab for DNA sequencing.

5. Is there a match?

DNA profile

The number of times a nucleotide sequence is repeated in each STR can be calculated from the size of the STRs. A forensic scientist can use this information to determine if a body fluid sample comes from a particular person.

If two DNA profiles from different samples are the same, then the chance that the samples came from different people is low. This provides strong evidence that the samples have a common source.

When is DNA profiling used?

• To identify the probable origin of a body fluid sample associated with a crime or crime scene.
• To reveal family relationships
• To identify disaster victims. For example, ESR scientists traveled to Thailand to help identify victims of the Boxing Day tsunami